• <div style="background-image:url(/live/image/gid/32/width/1600/height/300/crop/1/41839_V14Cover_Lynch_Artwork.2.rev.1520229233.png)"/>

Eukaryon

At the Crossroads of Neuroplasticity: dbcAMP- induced neurite growth in N2A cells suppressed by mitogen-activated protein kinase (MAPK) inhibitors, SB202190 and PD98059

Eliska Mrackova, Cade Brittain, and Michael Janecek
Department of Biology
Lake Forest College
Lake Forest, Illinois 60045

Abstract

Dopamine (DA) is a major neurotransmitter in the central nervous system, typically associated with the “reward circuit,” which projects from basal ganglia and mediates motivated behavior, such as wanting and liking. DA dysregulation is implicated in a host of neurological conditions, such as Parkinson’s, schizophrenia, ADHD, and addiction. Neurodegeneration in substantia nigra (SN) and ventral tegmental area (VTA) most drastically afflicts dopaminergic, or dopamine-producing, neurons. Recently discovered, atrophied brain cells can be replenished by inducing neuronal differentiation. This study used N2A mouse neuroblastoma cells capable of differentiation (Wu et al., 2008) in the presence of a mitogen-activated protein kinase (MAPK) pathway inducer, dbcAMP. We hypothesized that dbcAMP will induce morphological (neurite growth, dendritic branching) and functional (DA-specific gene expression) changes. Further, these changes should be reversible through the use of inhibitors acting on the MAPK pathway, specifically SB202190 and PD98059. We report successful and consistent differentiation (~70% ) of N2A cells into DA-producing neuron-like cells at day 1, marked by longer neurites, more dendritic growth, and specific expression of tyrosine hydroxylase (TH), NeuN, MAPT, and Tuj1 genes. As predicted, the functional and morphological modifications have been differentially inhibited using MAPK inhibitors, SB202190, and PD98059, such that dopamine-specific markers (TH, NeuN, Tuj1, and MAPT) were no longer differentially expressed. In other words, we found that the dbcAMP inducer, acting on the MAPK, induced N2A cell differentiation.

 

Key words: N2A, dopamine neurons, dbcAMP, SB202190, PD98059, NeuN, TH, Tuj1, MAPT

 

 

Introduction

At the cellular pharmacological level, a promising area of research examines strategies of replenishing atrophied substantia nigra neurons in Parkinson’s disease (PD) patients by inducing neuronal differentiation. Induced differentiation may compensate for the loss of neuronal regenerative capabilities by transforming somatic cells into morphologically distinct and functional neurons, offsetting cognitive decline in PD patients. In the case of PD, the challenge lies in producing in vitro dopaminergic neurons without the influence of glial cells and neurotrophic factors. Specifically, long-term sustainability and maturation of dopaminergic neurons from distinct cell lines remains to be persuasively resolved. Serum deprivation and/or the application of cyclic adenosine monophosphate (cAMP) analogs, growth factors, or derived neurotrophic factors remains a viable strategy (Tremblay et al., 2010). In this study, a neural crest-derived N2A, or Neuro2a, cell line has been selected for differentiation.

 

N2A mouse spontaneous neuroblastoma cells have been extensively studied in the context of neuronal differentiation, axonal growth, differentiation-preceding cell signaling, and neurite growth. N2A cells have been consistently evidenced to be capable of differentiating into functional neuronal cells (Tremblay et al., 2010; Wu et al., 2008). Thanks to their fast response to serum deprivation and environmental stimuli (e.g., cAMP analogs), observable through phosphorylation of extracellular signal-regulated kinase 1/2 (ERK1/2), epidermal factor growth, and Fos family immediate early gene transcription factor upregulation, N2A cells remain particularly useful in differentiation experiments. Similar to Tremblay and his colleagues (2010), this study aimed to generate and mature dopaminergic neurons from N2A cells by culturing them in the presence of dibutyryl cyclic adenosine monophosphate (dbcAMP), which acts on the cAMP responsive element binding protein (CREB) through the protein kinase A (PKA) pathway (Delghandi, 2005). Essential in developing the CNS, CREB serves as an effector on the cAMP response elements (CRE), which modifies promoters in the DNA sequence.

 

Dibutyryl cAMP (dbcAMP), a membrane-permeable cAMP analog, has been reported to induce neuritogenesis and synaptogenesis on N2A cells (Tremblay et al., 2010). dbcAMP causes an increase in the concentration of intracellular cAMP, causing an increased growth of neurites (Tojima et al., 2003). Furthermore, dbcAMP also promotes the intracellular delivery of PKA catalytic subunit inducing the neurite differentiation (Shea et al., 1992). Notably, dbcAMP acts on the MAPK pathway and can produce dopaminergic or cholinergic neurons, which specifically express mitotic and postmitotic biomarkers, such as tyrosine hydroxylase (TH), Tuj1, NeuN, and MAPT (Mena et al., 1995). Applied to neural stem/progenitor cells (NSPCs), dbcAMP has been found to induce up to 85% in vitro neuronal differentiation with functional implications, such as increased cell viability (Kim et al., 2011). In this experiment, dbcAMP was used in the presence of a lower serum concentration, which consisted of 2% FBS, or fetal bovine serum. Typically, 5% or 10% FBS concentrations are used to nourish the cell culture without inducing starvation (Couch, 2013). However, reducing the concentration to 0.5-2% has been observed to cause starvation at varying levels of toxicity; 2% FBS occupies the bottom non-toxic level, and it was selected for its starvation-inducing differentiation properties (Couch, 2013).

 

To test the role of MAPK pathway on dbcAMP-induced differentiation, we used 2 inhibitors: PD98059 (PD) and SB202190 (SB). Notably, PD, or (2-(2-Amino-3-methoxyphenyl)-4H-1-benzopyran-4-one), is a specific Raf/MEK1/2 inhibitor of the mitogen-activated protein kinase (MAPK) pathway, through which dbcAMP exerts differentiation (InvivoGen, CA, USA). In this manner, PD can inhibit cytokine signaling molecules, such as lipopolysaccharides. To inhibit MEK1/2 signaling, IC50 values of 4 µM and 50 µM are effective. Similarly, SB202190 is a MAPK inhibitor, but it targets p38 with IC50 efficiency of 50 nM/100 nM in cell-free assays. SB has also been found to inhibit GAK, CK1 and RIP2 proteins, which are a part of the MAPK pathway (Selleck Chemicals, Houston, TX). Interestingly, SB phosphorylates ERK, potentially inducing leukemia cell growth through the MAPK pathway.

 

We predict that the dbcAMP inducer will act on the MAPK pathway in N2A cells, thereby inducing neuronal differentiation in terms of morphological and functional changes, such that the neurons in the 2% FBS + dbcAMP condition will express Tuj1, NeuN, MAPT, and TH. The dbcAMP action should occur through the PKA-CREB pathway that targets CRE promoter, modifying DNA transcription. Furthermore, introducing SB202190 and PD98059 MAPK pathway inhibitors should inhibit the neurite growth induced by dbcAMP and block differentiation, such that no dopamine-specific neuron expression markers will be observed. The inhibitors are expected to have different potency, mirroring the different MAPK pathway aspects they target.

 

 

Materials and Methods

Mouse N2A Cell Culture

Rosalind Franklin University of Medicine and Science kindly provided N2A cells (Mouse Neuro 2a cells, ATCC® CCL-131™) (Tremblay et al., 2010), which were used throughout our experiment. N2A cells were kept in T-75 flasks in 10% Fetal Bovine Serum (FBS), which contained 50 ml FBS, 5 ml Penistrepto (PS), 5 ml glutamine, 5 ml Sodium Pyruvate.

 

Cell Differentiation Experiments

 In order to induce differentiation, 2% FBS combined with inducer dbcAMP was used. 2% FBS low serum medium was diluted from original concentration of 10% in 1:5 ratio. 2% FBS containing N2A cells was combined with an inducer dbcAMP (stock 100 mg/mL, FW= 491.4, 25 mg in 250ul of water). Morphology of the cells were assessed by counting number of cells with projections out of total number of cells in the image of each condition (3 photos at 40x magnification per condition). Length of neurites was analyzed using ImageJ software. In the next method, effect of the SB202190 inhibitor (MW= 331.34 g/mol, faint yellow color, dilution 1:1500, optima concentration 1ug/ml, 4ul per each well) was observed. Similarly, the effect of the PD98059 inhibitor (dilution 1:400, 40ul per each well) was observed and compared to the effect of the SB202190 inhibitor on cell differentiation and cell count.

 

RNA Extraction

TheIBI Total RNA Mini Kit Protocol was used for RNA extraction. In order to analyze the isolated RNA concentration, a NanoDrop spectrophotometer was applied. Furthermore, a MidSci EasyScript cDNA kit was used for reverse transcription procedure. Using a tubulin primer as a housekeeping gene Sybr Green RT-PCR, four different primers -  Tuj1, TH, NeuN, and MAP 1 - were utilized in our experiments to assess the level of differentiation.

 

Mrackova Fig 1

Fig. 1. Experimental design: N2A neuroblastoma mouse cells were kept in 2% FBS. RNA extraction of the N2A cells were followed by reverse transcription. N2A cDNA was used for real time PCR to determine the effect of dbcAMP, PD98059, and SB202190 on the gene expression.

 

Name

Synthesis

Forward Sequence

Reverse Sequence

Tuj1

10 nmol

TAGACCCCAGCGGCAACTAT

GTTCCAGGTTCCAAGTCCACC

TH

10 nmol

TGTTGGCTGACCGCACAT

GCCCCCAGAGATGCAAGTC

MAP1

10 nmol

CGCTGGGCATGTGACTCAA

TTTCTTCTCGTCATTTCCTGTCC

NeuN

10 nmol

GGGTATGGGTAGGATTGGG

GTGGAAGGTTTCACTACAACAGA

 mTUB

250uM (50x)

GCATCTCCATCCATCCATGTTGGC

GGCAGTAGAGAGCTCCCAGCAG

Real Time PCR (RT-PCR)

The RNA from dbcAMP induced N2A cells, along with the presence of SB202190 or PD98059 inhibitors, was extracted and quantified. First, cDNA was extracted and isolated, and the cDNA fragments were amplified. cDNA fragments were amplified using the following conditions: 1. At 94 ͦC cDNA denatured for 5 minutes, 2. 25-30 denaturing cycles at 94 ͦC, 3. annealing at 60 ͦC and elongating for 45 s at 72 ͦC. The final and longest cycle of elongation lasted for 5 minutes.

 

Statistical analysis

Data from our labs consisted of the number of living and dead cells counted using the hemocytometer, the number of neurites per cell, and the length of neurites. We analyzed our data with a two-way ANOVA test.

 

 

Results

Effects of dbcAMP on live/dead cell ratio and cell morphology

In order to visualize the effects of dbcAMP, ratio of live/dead cells, number of neurites per cells, length of neurites, and percentage of differentiated cells was analyzed. On day 1, N2A cells showed the highest rate of growth, lowest number of dead cells, and the longest neurite length (Figure 1). On day 3, with a decreasing concentration of nutrients in the 2% FBS, the numbers of dead cells increased, the length of neurites decreased, and the rate of growth slowed down (Figure 1A-L). In experiment 3, a neuron with axonal projections and dendrites was captured using the light microscope (Figure 1I). N2A cells with the dbcAMP inducer yielded in 25000 living cells compared to the N2A cells with only 10000 surviving cells (Figure 1J). Furthermore, dbcAMP induced differentiation in 35% of N2A cells on day 1. On day 3, the percentage of differentiated cells decreased to 9% (Figure 2A-B). Overall, dbcAMP induced cell survival rates, cell differentiation, and increased the number of neurites.

 

Effects of MAPK Inhibitor PD98059

In order to visualize the effects of the PD98059 inhibitor on the MAPK pathway, the ratio of live/dead cells, number of neurites per cells, length of neurites and percentage of differentiated cells was analyzed. Our PD98059 inhibitor was used to inhibit the effect of the dbcAMP inducer, thus decreasing the neurite growth and the number of living cells. In order to determine if MEK is involved in dbcAMP-induced neurite growth, we treated the cells with PD. Interestingly, the experiments with our PD98059 inhibitor yielded  more neurite growth than our first experiment with our inducer (Figure 1 A-J). The PD inhibitor resulted in cells with more circular shape and fewer neurite projections (Figure 1D). The PD inhibitor caused a decrease from an average of 3 neurites per cell in the dbcAMP condition to less than 2 dendrites in the PD condition per cell on day 1 (Figure 3A). Furthermore, on day 1 dbcAMP induced 57% of N2A cells to differentiate, compared to the control of only N2A cells. The PD98059 inhibitor caused only 34% of cells to differentiate comparable to the control (Figure 3B). On day 1, the dbcAMP condition yielded in the longest rate of neurite growth resulting in 28.08 μm on average. PD98059 significantly decreased the length of the dendrite to 16.08 μm on average (Figure 5A). Overall, the PD inhibitor was found to have an effect on cell proliferation, thus decreasing the rates of differentiation.

 

 Mrackova Fig 2

Mrackova Fig 3

Fig. 1. Differentiation of N2A neuroblasts into. (A) 2%FBS N2A, day 1. (B) 2%FBS N2A, day 3. (C) 2%FBS N2A, day 1. (D) 2%FBS N2A + dbcAMP + PD98059, day 1. (E) 2%FBS N2A + dbcAMP, day 1. (F) 2%FBS N2A + PD98059, day 1. (G) 2%FBS N2A, day 1. (H) 2%FBS N2A + dbcAMP, day 1.(I) 2%FBS N2A + dbcAMP + SB202190, day 1. (J) 2%FBS N2A + SB202190, day 1. (K) differential effects on dbcAMP and PD98059 on cell growth on day 1. PD98059 inhibitor increased the number of death cells and reduced the number of live cells. .PD, in the presence of dbcAMP, reduced cell growth compared to the FBS 2% control. (L) Cell growth induced by dbcAMP in the presence of SB202190 inhibitor on day 1.

Mrackova Fig 4

Fig. 2. Differentiation of N2A neuroblasts with dbcAMP inducer into neurites on day 1 and day 3. (A) On day 1, dbcAMP inducer caused significantly more differentiation observed in terms of neurite growth. (B) On day 3, dbcAMP inducer caused significantly more differentiation observed in terms of neurite growth. Rate of differentiation has slowed down compared to day 1 (A).

 

Effects of MAPK Inhibitor SB202190

In order to visualize the effects of the PD98059 inhibitor on the MAPK pathway, ratio of live/dead cells, number of neurites per cells, length of neurites, and percentage of differentiated cells was analyzed. To determine the role of p38 MAPK on cell growth and differentiation, we treated the N2A cells with the SB202190 inhibitor. N2A cells with dbcAMP inducer yielded 25000 living cells compared to N2A cells with only 10000 surviving cells (Figure 1J). SB inhibitor exhibited even lower rate of surviving N2A cells on day 1 than PD inhibitor on day 1 (Figure 1K-L). Similar to the PD98059 inhibitor, the SB202190 yielded circular cells with fewer neuronal projections. The effect of the SB inhibitor on the mean number of dendrites was less pronounced than in the PD condition. Although SB+dbcAMP showed an increase in the mean number of dendrites per cell, this result was not significant (p >.05). The condition of our negative control (PD inhibitor) showed only 1 neurite per cell on average (Figure 4A). Interestingly, the SB inhibitor had a different effect on the percentage of differentiation compared to the PD inhibitor (Figure 4A). The dbcAMP + SB condition yielded in the same rate of differentiation as our dbcAMP inducer condition. Our negative control of only PD inhibitor resulted in a 0% differentiation rate. The length of neurites in experiment 3 was not a measure, as there was no significant effect of the SB inhibitor on N2A differentiation. Overall, the SB inhibitor increased cell death without affecting the number of neurites and their length, relative to the dbcAMP inducer condition, suggesting that its MAPK pathway blockade failed or that it was not sufficient in reversing the induction of differentiation.

 

 Mrackova Fig 5

Fig. 3. Differentiation of N2A neuroblasts with dbcAMP inducer and PD98059 into neurites on day 1 and day 3. (A) On day 1, dbcAMP cells had significantly more dendrites per cell compared to the FBS 2% control, or PD98059 inhibitor conditions. (B), PD inhibitor reduced the rate of differentiation in the dbcAMP + PD condition,

Mrackova Fig 6

Fig. 4. Differentiation of N2A neuroblasts with the dbcAMP inducer and SB202190 into neurites on day 1 and day 3. (A) PD inhibitor reduced the rate of differentiation in the dbcAMP + PD condition. (B) When compared to control 2% FBS, dbcAMP showed more cell differentiation. No difference was observed in cell differentiation between the dbcAMP and the dbcAMP + SB condition. Furthermore, SB alone caused cell death and no differentiation.

Mrackova Fig 7

Mrackova Fig 8

Fig. 5A. In experiment 3 on day 1, the PD inhibitor robustly inhibited neurite growth, but day 2 exhibited neurite growth similar to other conditions. Surprisingly, dbcAMP did not induce neurite growth as observed before. No neurites were observed on day 2 of the FBS 2% control condition. Fig. 5B. In experiment 1, dbcAMP induced neurite growth at day 1. FBS 2% control produced some neurite growth at day 1, but all of the observed projections atrophied by day 3. In contrast, dbcAMP induced major neurite growth on both day 1 and day 3. On average, neurites of cells in the dbcAMP condition on day 1 measured 21.56 µm, whereas on day 3 they shrank to 11.72 µm.

Mrackova Fig 9

Fig. 6. The effect of the dbcAMP inducer, SB202190 and PD98059 inhibitors on gene expression. Differential expression of dopaminergic genes in dbcAMP-induced cells. (A) Tyrosine hydroxylase (TH) is specifically expressed in dbcAMP cells, but not in any other condition. (B) Tuj1 is increased in dbcAMP induced N2A cells. (C) NeuN marking the growth and differentiation of neurites. (D) MAPT marking a microtubule associated protein tau.

 

dbcAMP induces neuronal gene expression

After observing the effects of dbcAMP, PD98059, and SB202190 on cell differentiation and cell survival, quantitative PCR was used to determine the effects on gene expression. The effect of dbcAMP was determined by the number of TH-positive neurons. TH showed a significant effect on dbcAMP induced cell differentiation (Figure 6A). Another neuronal progenitor marker used in this experiment, Tuj1also showed  a significant effect of dbcAMP induced cell differentiation compared to the control and inhibitors PD and SB (Figure 6B). NeuN, neuronal nuclei antigen, is predominantly present in postmitotic marking the maturation of cells. Unfortunately, not enough SB202190 was available for NeuN and MAPT and thus was not used in our experiment (Figure 6C-D).

 

Furthermore, all four neuronal markers mark cell differentiation at different stages. Tuj-1 marks early neurons, whereas NeuN and MAPT marks more mature neurons. Our results showed that Tuj-1 and MAPT had a higher effect of dbcAMP on gene expression compared to lower levels of TH and NeuN (Figure 6). Inhibitors PD and SB in TH and Tuj-1 neuronal markers showed significantly lower levels of gene expression. In the NeuN and MAPT condition, PD98059 showed decreased levels of gene expression, which were comparable to the positive control gene . Because these target genes are all neuronal markers, this indicates that dbcAMP increased the expression of these neuronal genes by 6.6 fold (TH), 12.3 fold (Tuj1), 16.1 fold (MAPT), and 3.4 fold (NeuN).

 

Discussion

In previous years, inducing neuronal differentiation using N2a cell cultures has developed multiple methods (Wu et al., 1998; Saragoni et al., 2000; Dickey et al., 2004). However, these methods are not created to specifically produce N2a dopaminergic neurons. Relatively recent research demonstrates that N2a cells are able to be differentiated selectively into N2a dopaminergic neurons using the inducer dibutyryl cyclic adenosine monophosphate (dbcAMP) (Tremblay et al., 2010). Using the dbcAMP inducer, we exhibited similar results to Tremblay et al (2010). Furthermore, dbcAMP demonstrated to have a consistently beneficial effect on N2A cell differentiation using the MAPK pathway through all four aims.

 

First we focused on dbcAMP’s inducing effect on N2a cells compared to a control 2% FBS condition by examining N2a percent cell differentiation over a three-day period. Day 1 results displayed a significant increase in % N2a differentiation in the dbcAMP condition (See Fig. 2). Day 3 results also displayed similar results but % N2a differentiation was severely impacted due to a large increase in dead cells from not changing the media (See Fig. 2). These results informed us that dbcAMP appeared to be having a significant impact on N2a cell differentiation.

 

After we confirmed successful induction of % N2a differentiation using dbcAMP, we explored the mechanism pathway that dbcAMP utilizes. To determine the mechanism, we decided to test the neuronal inhibitor, SB202190, in addition to dbcAMP/control conditions over a three-day period. Previous research describes SB202190 as a MAPK pathway inhibitor by suppressing p38 (Wang et al., 2011). As expected, day 2 results displayed largest % N2a differentiation for the dbcAMP condition with SB202190 conditions exhibiting the lowest differentiation (See Fig. 4). These results proved consistent with aim one results in regards to increase in dbcAMP N2a cell differentiation relative to control and inhibiting conditions. It is difficult to determine whether dbcAMP had a positive effect on inducing cell growth. Each separate day cell number recordings demonstrated different results (See Fig. 1). Despite cell growth numbers, because our SB conditions exhibited the lowest % N2a differentiation relative to control and dbcAMP conditions, this confirms that dbcAMP may have involvement with the MAPK pathway as a mechanism to increase cell differentiation.

 

To further reinforce that dbcAMP is utilizing the MAPK pathway to induce differentiation, we decided to test the neuronal inhibitor PD98059 over a one-day period. Previous research indicates that PD98059 is an inhibitor of Raf/MEK in the MAPK pathway. Consistent with our previous experiments, the results displayed dbcAMP significantly inducing the largest % N2a differentiation. Interestingly, in contrast to the previous experiment with SB202190, the control, dbcAMP + PD, and PD conditions all had relatively similar amounts of differentiation. Nonetheless, it is important to note that differentiation for PD98059 inhibitor conditions remained significantly lower relative to the dbcAMP condition. Again, it is difficult to determine the effect of dbcAMP and PD98059 on overall cell growth. Even though dbcAMP had the highest estimated living cells, the dbcAMP condition also had larger amount of dead cells (See Fig. 1). Even when using a different neuronal inhibitor that suppresses a different area in the MAPK pathway, results remained consistent. This further provides evidence for dbcAMP inducing cell differentiation by utilizing the MAPK pathway.

 

Following the conformation of dbcAMP using the MAPK pathway for N2a differentiation, we decided to focus on confirming that the induced morphology was due to neuronal differentiation from dbcAMP. To accomplish this task, RT PCR was employed. RT PCR allowed us to target and quantify specific neuronal markers. Through all four determined target genes (TH, Tuj1, MAPT, & NeuN), it was observed that the dbcAMP condition consistently and significantly had the largest average fold change. This provided crucial evidence of dbcAMP inducing morphological changes in N2a cells which represents differentiation. Interestingly, because TH is a neuronal marker for dopaminergic neurons, our results may suggest that dbcAMP also successfully induced N2a differentiation into specifically dopaminergic neurons.

 

Ultimately, the outcome of our data appears to be consistent across all experiments and with our hypothesis. This indicates that dbcAMP induced neuronal differentiation in terms of morphological and functional changes into neurons by acting on the MAPK pathway. Research with dbcAMP and generating dopaminergic neurons remains scarce. However, our RT PCR results of dbcAMP having the largest average fold change in TH neuronal gene was similar with the RT PCR results from Tremblay et al, 2010.

 

Further research is needed, starting with additional trials for each aim to further confirm the success of dbcAMP as an N2a cell dopaminergic neuron inducer and to confirm SB202190 and PD98059 as inhibitors of the MAPK pathway. Since Tremblay’s research demonstrates that GDNF has similar effects to dbcAMP on N2a cells while RA has antagonistic effects, ​it would be interesting to test different inducers such as GDNF, RA, or even an alternative cell line. Nevertheless, if dbcAMP proves to be a successful inducer of dopaminergic neurons, further steps can be established to examine if dopamine is being produced and to examine the molecular pathway that dbcAMP induces. This research may then lead towards the direction of potentially inducing dopaminergic neuron growth in mice. Even though many steps still remain, hopefully research with dbcAMP will eventually find a solution to treat patients with disorders involving dopamine deficiencies.

 

References

Kwon, J., Lee, N., Jeon, I., Lee, H., Do, J., & Song, J. (2012). Neuronal Differentiation of a Human Induced Pluripotent Stem Cell Line (FS-1) Derived from Newborn Foreskin Fibroblasts. Int J Stem Cells, 5(2).

Shea, T., Beermann, M., Leli, U., & Nixon, R. (1992). Opposing influences of protein kinase activities on neurite outgrowth in human neuroblastoma cells: Initiation by kinase A and restriction by kinase C. Journal Of Neuroscience Research, 33(3), 398-407. http://dx.doi.org/10.1002/jnr.490330306

Tojima, T., & Ito, E. (2001). A cyclic AMP-regulated negative feedforward system for neuritogenesis revealed in a neuroblastoma×glioma hybrid cell line. Neuroscience, 104(2), 583-591. http://dx.doi.org/10.1016/s0306-4522(01)00061-6

Tremblay, R., Sikorska, M., Sandhu, J., Lanthier, P., Ribecco-Lutkiewicz, M., & Bani-Yaghoub, M. (2010). Differentiation of mouse Neuro 2A cells into dopamine neurons. Journal Of Neuroscience Methods, 186(1), 60-67. http://dx.doi.org/10.1016/j.jneumeth.2009.11.004

 

Wang, X., Wang, Z., Yao, Y., Li, J., Zhang, X., & Li, C. et al. (2011). Essential role of ERK activation in neurite outgrowth induced by α-lipoic acid. Biochimica Et Biophysica Acta (BBA) - Molecular Cell Research, 1813(5), 827-838. http://dx.doi.org/10.1016/j.bbamcr.2011.01.027

 

Wu, H., Ichikawa, S., Tani, C., Zhu, B., Tada, M., & Shimoishi, Y. et al. (2009).

Disclaimer

Eukaryon is published by students at Lake Forest College, who are solely responsible for its content. The views expressed in Eukaryon do not necessarily reflect those of the College.

Articles published within Eukaryon should not be cited in bibliographies. Material contained herein should be treated as personal communication and should be cited as such only with the consent of the author.